Mature sequence atr-miR171a

Accession numberMIMAT0033924
IDatr-miR171a
Stem-Loop atr-MIR171a
Sequence
ugauugagccgcgccaauauc
Get sequence
Deep sequencing5037 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).