Mature sequence atr-miR319e

Accession numberMIMAT0033932
IDatr-miR319e
Stem-Loop atr-MIR319e
Sequence
uuuggacugaagggagcuccu
Get sequence
Deep sequencing47357 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).