Mature sequence atr-miR393

Accession numberMIMAT0033935
IDatr-miR393
Stem-Loop atr-MIR393
Sequence
uccaaagggaucgcauugaucc
Get sequence
Deep sequencing906 reads, 3 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).