Mature sequence atr-miR395

Accession numberMIMAT0033937
IDatr-miR395
Stem-Loop atr-MIR395
Sequence
cugaaguguuugggggaacuc
Get sequence
Deep sequencing401 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).