Mature sequence atr-miR396c

Accession numberMIMAT0033940
IDatr-miR396c
Stem-Loop atr-MIR396c
Sequence
uuccacagcuuucuugaacuu
Get sequence
Deep sequencing360492 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).