Mature sequence atr-miR397a

Accession numberMIMAT0033943
IDatr-miR397a
Stem-Loop atr-MIR397a
Sequence
uccuugagugcagcguugaug
Get sequence
Deep sequencing3782 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).