Mature sequence atr-miR398

Accession numberMIMAT0033945
IDatr-miR398
Stem-Loop atr-MIR398
Sequence
uguguucccaggucgccccug
Get sequence
Deep sequencing22116 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).