Mature sequence atr-miR8615

Accession numberMIMAT0033950
IDatr-miR8615
Stem-Loop atr-MIR8615
Sequence
cuuguagguaugauuccacgca
Get sequence
Deep sequencing1359 reads, 3 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).