Mature sequence sly-miR164a-3p

Accession numberMIMAT0033974
IDsly-miR164a-3p
Stem-Loop sly-MIR164a
Sequence
caugugccuguuuuccccauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24085581 "The tomato NAC transcription factor SlNAM2 is involved in flower-boundary morphogenesis" Hendelman A, Stav R, Zemach H, Arazi T J Exp Bot. 64:5497-5507(2013).