Mature sequence gra-miR8653a

Accession numberMIMAT0034012
IDgra-miR8653a
Stem-Loop gra-MIR8653a
Sequence
uaaaucuacguauggaaauuc
Get sequence
Deep sequencing reads, experiments

References

1