Mature sequence gra-miR8749

Accession numberMIMAT0034175
IDgra-miR8749
Stem-Loop gra-MIR8749
Sequence
ucucggacccucaacggaagg
Get sequence
Deep sequencing reads, experiments

References

1