Mature sequence dme-miR-9373-5p

Accession numberMIMAT0035209
IDdme-miR-9373-5p
Stem-Loop dme-mir-9373
Sequence
aguuugugaggagcguucggc
Get sequence
Deep sequencing8 reads, 7 experiments

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).