Mature sequence dme-miR-9388-5p

Accession numberMIMAT0035238
IDdme-miR-9388-5p
Stem-Loop dme-mir-9388
Sequence
guauguauguauguacauacaug
Get sequence
Deep sequencing60 reads, 9 experiments
Database links
QuickGO function

References

1
PMID:23882112 "The impact of age, biogenesis, and genomic clustering on Drosophila microRNA evolution" Mohammed J, Flynt AS, Siepel A, Lai EC RNA. 19:1295-1308(2013).