Mature sequence xtr-miR-9407

Accession numberMIMAT0035361
IDxtr-miR-9407
Sequence
ugcgcucgguggauagaagacguga
Get sequence
Stem-Loop xtr-mir-9407

References

1
PMID:24065776 "Small RNA profiling of Xenopus embryos reveals novel miRNAs and a new class of small RNAs derived from intronic transposable elements" Harding JL, Horswell S, Heliot C, Armisen J, Zimmerman LB, Luscombe NM, Miska EA, Hill CS Genome Res. 24:96-106(2014).