Mature sequence nve-miR-9454

Accession numberMIMAT0035415
IDnve-miR-9454
Stem-Loop nve-mir-9454
Sequence
uaccaggucacuguuuuugagg
Get sequence
Deep sequencing450 reads, 21 experiments

References

1
PMID:24642861 "Cnidarian microRNAs frequently regulate targets by cleavage" Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H Genome Res. 24:651-663(2014).