Mature sequence dvi-miR-190-5p

Accession numberMIMAT0035560
IDdvi-miR-190-5p
Stem-Loop dvi-mir-190
Sequence
agauauguuugauauucuugguug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).