Mature sequence mmu-miR-3154

Accession numberMIMAT0035714
IDmmu-miR-3154
Stem-Loop mmu-mir-3154
Sequence
cagaaggggagucgggagcgga
Get sequence
Deep sequencing51 reads, 24 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).