Mature sequence bfv-miR-BF1-5p

Accession numberMIMAT0035753
IDbfv-miR-BF1-5p
Stem-Loop bfv-miR-BF1
Sequence
uucggaggauggcucaucaagc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24522910 "Identification of novel, highly expressed retroviral microRNAs in cells infected by bovine foamy virus" Whisnant AW, Kehl T, Bao Q, Materniak M, Kuzmak J, Lochelt M, Cullen BR J Virol. 88:4679-4686(2014).