Mature sequence chi-miR-2284d

Accession numberMIMAT0036080
IDchi-miR-2284d
Stem-Loop chi-mir-2284d
Sequence
gaaaccugaacaaacuuuuugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).