Mature sequence chi-miR-2318

Accession numberMIMAT0036082
IDchi-miR-2318
Stem-Loop chi-mir-2318
Sequence
cguguaugaugaauuaucugacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).