Mature sequence chi-miR-490

Accession numberMIMAT0036250
IDchi-miR-490
Stem-Loop chi-mir-490
Sequence
caaccuggaggacuccaugcugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).