Mature sequence gma-miR319p

Accession numberMIMAT0036379
IDgma-miR319p
Stem-Loop gma-MIR319p
Sequence
uuuuggacugaagggagcucc
Get sequence
Deep sequencing reads, experiments

References

1