Mature sequence tch-miR-98-5p

Accession numberMIMAT0036570
IDtch-miR-98-5p
Stem-Loop tch-mir-98
Sequence
ugagguaguaaguuguauuguu
Get sequence
Deep sequencing reads, experiments

References

1