Mature sequence tch-miR-25-3p

Accession numberMIMAT0036590
IDtch-miR-25-3p
Stem-Loop tch-mir-25
Sequence
cauugcacuugucucggucuga
Get sequence
Deep sequencing reads, experiments

References

1