Mature sequence tch-let-7i-5p

Accession numberMIMAT0036604
IDtch-let-7i-5p
Stem-Loop tch-let-7i
Sequence
ugagguaguaguuugugcuguu
Get sequence
Deep sequencing reads, experiments

References

1