Mature sequence tch-let-7e-5p

Accession numberMIMAT0036620
IDtch-let-7e-5p
Stem-Loop tch-let-7e
Sequence
ugagguaggagguuguauaguu
Get sequence
Deep sequencing reads, experiments

References

1