Mature sequence bta-miR-3432b

Accession numberMIMAT0036976
IDbta-miR-3432b
Stem-Loop bta-mir-3432b
Sequence
uucgggaucuuuaguuguggu
Get sequence
Deep sequencing4142 reads, 66 experiments
Predicted targets

References

1
PMID:24021155 "Profiling microRNA expression in bovine alveolar macrophages using RNA-seq" Vegh P, Foroushani AB, Magee DA, McCabe MS, Browne JA, Nalpas NC, Conlon KM, Gordon SV, Bradley DG, MacHugh DE, Lynn DJ Vet Immunol Immunopathol. 155:238-244(2013).