Mature sequence ssc-miR-9808-3p

Accession numberMIMAT0037026
IDssc-miR-9808-3p
Stem-Loop ssc-mir-9808
Sequence
ccuugcagggugucggauacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).