Mature sequence ssc-miR-9843-3p

Accession numberMIMAT0037061
IDssc-miR-9843-3p
Stem-Loop ssc-mir-9843
Sequence
ucugugaacuagaaaccucugg
Get sequence
Deep sequencing125 reads, 12 experiments

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).