Mature sequence ssc-miR-96-5p

Accession numberMIMAT0037085
IDssc-miR-96-5p
Stem-Loop ssc-mir-96
Sequence
uuuggcacuagcacauuuuugcu
Get sequence
Deep sequencing2428 reads, 15 experiments

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).