Mature sequence rno-miR-676

Accession numberMIMAT0037264
IDrno-miR-676
Stem-Loop rno-mir-676
Sequence
ccguccugagcuugucgagcua
Get sequence
Deep sequencing247400 reads, 493 experiments
Predicted targets

References

1
PMID:23799049 "Distinctive profile of IsomiR expression and novel microRNAs in rat heart left ventricle" McGahon MK, Yarham JM, Daly A, Guduric-Fuchs J, Ferguson LJ, Simpson DA, Collins A PLoS One. 8:e65809(2013).