Mature sequence ame-miR-2b-5p

Accession numberMIMAT0037292
IDame-miR-2b-5p
Stem-Loop ame-mir-2b
Sequence
ucaucaaagcuggcugugauauga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
2
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).