Mature sequence gga-miR-363-5p

Accession numberMIMAT0037553
IDgga-miR-363-5p
Stem-Loop gga-mir-363
Sequence
guggaucacgaugcaauuuuga
Get sequence
Deep sequencing1336 reads, 5 experiments

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).
2
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).