Mature sequence cli-miR-7a-2-3p

Accession numberMIMAT0038398
IDcli-miR-7a-2-3p
Stem-Loop cli-mir-7a-2
Sequence
caacaagucacagucugcccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).