Mature sequence dya-miR-2498-5p

Accession numberMIMAT0039166
IDdya-miR-2498-5p
Stem-Loop dya-mir-2498
Sequence
uuaagucuguucugcuuagauu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).