Mature sequence bta-miR-2285aj-5p

Accession numberMIMAT0040947
IDbta-miR-2285aj-5p
Stem-Loop bta-mir-2285aj
Sequence
ugaaaaguucguuuggguuuuu
Get sequence
Deep sequencing170738 reads, 77 experiments

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).