Mature sequence bta-miR-2285al-5p

Accession numberMIMAT0040949
IDbta-miR-2285al-5p
Stem-Loop bta-mir-2285al
Sequence
acaaaguuuguucggguuuua
Get sequence
Deep sequencing310 reads, 28 experiments

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).