Mature sequence bta-miR-2285am-5p

Accession numberMIMAT0040950
IDbta-miR-2285am-5p
Stem-Loop bta-mir-2285am
Sequence
aaaaaguuaguuuagguuuuu
Get sequence
Deep sequencing136 reads, 51 experiments

References

1
PMID:25458694 "Regulating life or death: potential role of microRNA in rescue of the corpus luteum" Maalouf SW, Liu WS, Albert I, Pate JL Mol Cell Endocrinol. 398:78-88(2014).