Mature sequence egr-miR-10233-5p

Accession numberMIMAT0041209
IDegr-miR-10233-5p
Stem-Loop egr-mir-10233
Sequence
uugcacagcuuagagcucuguc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25168356 "Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus" Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, Li X, Ma F, Zhao L, Shi B, Li J, McManus DP, Zhang W, Wang S BMC Genomics. 15:736(2014).