Mature sequence sfr-miR-279b-3p

Accession numberMIMAT0041968
IDsfr-miR-279b-3p
Stem-Loop sfr-mir-279b
Sequence
ugacuagauuaucacuuauccu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).