Mature sequence fve-miR156h

Accession numberMIMAT0044484
IDfve-miR156h
Stem-Loop fve-MIR156h
Sequence
ugacagaagagagugagcuc
Get sequence
Deep sequencing reads, experiments

References

1