Mature sequence bta-miR-2285bh

Accession numberMIMAT0046388
IDbta-miR-2285bh
Stem-Loop bta-mir-2285bh
Sequence
aaagguucguucggguuuuucu
Get sequence
Deep sequencing6219 reads, 65 experiments

References

1
PMID:27100870 "Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells" Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM PLoS One. 11:e0154129(2016).