Mature sequence bta-miR-2285bl

Accession numberMIMAT0046623
IDbta-miR-2285bl
Stem-Loop bta-mir-2285bl
Sequence
aaaaccugaaugaacucuuuggu
Get sequence
Deep sequencing7422 reads, 73 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).