Mature sequence bta-miR-2285bm

Accession numberMIMAT0046624
IDbta-miR-2285bm
Stem-Loop bta-mir-2285bm
Sequence
aaaaaaccgaguggacuuuuug
Get sequence
Deep sequencing2078 reads, 39 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).