Mature sequence bta-miR-2285br

Accession numberMIMAT0046636
IDbta-miR-2285br
Stem-Loop bta-mir-2285br
Sequence
aaaaccugaaugaacuuucugu
Get sequence
Deep sequencing7724 reads, 73 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).