Mature sequence bta-miR-2285bv

Accession numberMIMAT0046642
IDbta-miR-2285bv
Stem-Loop bta-mir-2285bv
Sequence
aaaacacucgaacaaacauuuu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).