Mature sequence bta-miR-2285bw

Accession numberMIMAT0046643
IDbta-miR-2285bw
Stem-Loop bta-mir-2285bw
Sequence
agaaaaaccgaaaugaacuuuu
Get sequence
Deep sequencing61 reads, 27 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).