Mature sequence bta-miR-2285bx

Accession numberMIMAT0046644
IDbta-miR-2285bx
Stem-Loop bta-mir-2285bx
Sequence
aaaaguucguucgauuuuuccu
Get sequence
Deep sequencing57 reads, 6 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).