Mature sequence bta-miR-2285ca

Accession numberMIMAT0046650
IDbta-miR-2285ca
Stem-Loop bta-mir-2285ca
Sequence
aagggaccugaaugaacuuuuug
Get sequence
Deep sequencing433 reads, 67 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).