Mature sequence bta-miR-1264

Accession numberMIMAT0046656
IDbta-miR-1264
Stem-Loop bta-mir-1264
Sequence
caagucuuauuugagcaccugu
Get sequence
Deep sequencing2 reads, 1 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).